Objective: in the gene encoded miRNAs may

Objective: MicroRNAs (miRNAs) play significant roles in several physiological procedures such as successful pregnancy. Recently, findings have indicated that aberrant miRNAs gene expression and single nucleotide polymorphism in the gene encoded miRNAs may be contributed in the pathogenesis of recurrent pregnancy loss (RPL). This investigation aimed to examine potential associations between the two precursor miRNA SNPs miR-196a2 T > C and miR-499 A > G and susceptibility to RPL.  

Materials and Methods: We were analyzing a total of 200 subjects, which was consisting of 100 women experienced three or more recurrent miscarriages and 100 healthy women with one child and without historical aberrations. miR-499 A>G and miR-196a2 T>C gene polymorphisms were performed by Polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP) technique to assess the association between the presence miRNA gene variant and with the risk of RPL.

Best services for writing your paper according to Trustpilot

Premium Partner
From $18.00 per page
4,8 / 5
4,80
Writers Experience
4,80
Delivery
4,90
Support
4,70
Price
Recommended Service
From $13.90 per page
4,6 / 5
4,70
Writers Experience
4,70
Delivery
4,60
Support
4,60
Price
From $20.00 per page
4,5 / 5
4,80
Writers Experience
4,50
Delivery
4,40
Support
4,10
Price
* All Partners were chosen among 50+ writing services by our Customer Satisfaction Team

Results: Genetic variant analysis of the RPL and healthy women for the miR-499 A>G and miR-196a2 T>C polymorphisms was dont showed positive a significant association between the cases and control groups (p = 0.091; OR = 1.07; 95% CI, 0.81-1.92) and (p= 0.904; OR = 0.97; 95% CI, 0.61-1.32) respectively.

Conclusion:  Our findings proposed that  T>C and A>G nucleotide changes in pri-miR-196a2 and the pri-miR-499 gene encoding region can not contribute to the genetic predisposition to RPL.

Keywords: MicroRNAs, recurrent pregnancy loss, SNP, RPL,  miR-196a2.

 

 

 

Introduction

Recurrent pregnancy loss (RPL) was defined as a phenomenon of two or more consecutive pregnancies that lead to the miscarriage of the fetus, before about 20 weeks of gestation, affecting nearly 1–5% of women (Ghorbian et al, 2012). Different internal and external factors have been reported that related to the miscarriage, including uterine anomaly, chromosomal abnormalities, endocrine disorders, hematopoietic disease, immune dysfunctions, lifestyle and maternal infections (Hu et al, 2011). The previous investigation indicated that two to seven fold increase the prevalence of RPL among first-degree blood relatives compared to the background population (Hu et al, 2014). Unexplained RPL is a stressful status of the couple. Only supportive attention is assistance effort to the overwhelming of the matter (Hu et al, 2011).  The problems up to 50% of patients suffering to the RPL remained obscure. Therefore, investigations focusing on embryonic genetic agents can be critical filed to defining the etiologies of spontaneous miscarriages.  miRNAs are a new class of small non-coding RNAs, which play crucial functions in all of the organism genomes. miRNAs are a family of 21–25-nucleotide small RNAs that, negatively regulated gene expression at the post-transcriptional level (Hu et al, 2011; Jeon et al, 2012). miRNAs play as a leader molecule in post-transcriptional gene silencing through base pairing with purpose mRNAs, which leads to mRNA cleavage or translational repression. To-date investigations have implicated that the vital roles of miRNAs in endometriosis, pre-eclampsia, and infertility. The preliminary investigation was performed in gene expression pattern in the endometrium specimens and confirmed the crucial effect of several miRNAs, such as miR-20a, miR-21, and miR-26a in the manifestation of phenomena (Pan et al, 2007). In addition,  the study of miRNA expression models in subjects with male infertility and polycystic ovary syndrome (PCOS) reported the unusual expression of let-7a and miR-24 (McCallie et al 2010), which could be contributing to the cell proliferation and cell adhesion procedures (Pickering et al, 2009; McCallie et al, 2010; He et al, 2010). Some of miRNA SNPs revealed that a contradictory influence on the mature miRNA expression and miRNA processing (Wang et al, 2016; Wang et al, 2016). The preliminary finding revealed interaction site polymorphism of miRs has been associated with unexplained male infertility (Zhang  et al, 2011). These findings suggested that the miRNAs may be necessary for the natural function of the conceptual process. The earlier investigation has been evaluated significant potential roles of other miRNAs in the recurrent miscarriage (Jeon et al, 2012). Due to the conflicting of before declaring data and speculated that these molecules may be contributing to the increase of RPL phenomena, we endeavored to investigate potential connections between the two precursor miRNA SNPs miR-196a2 T > C and miR-499 A > G gene polymorphism with the risk of RPL in the East Azerbaijan Province of Iran, Tabriz populations.

 

 

 

Materials and Methods

2.1 Sample selection

All subjects with RPL have preferred the women, which were referred to the Tabriz International Hospital from of August 2015 to October 2016 for the evaluation of RPL causes. In the present investigation, we selected 100 cases with RPLs, who had no identified reason of RPL. Women with RPL mean age ± standard deviation (S.D.), 32.05 ± 2.72 years had at least 2 spontaneous abortions (mean 4, range 3-6) and no history of satisfied productivity. All collected samples with primary miscarriage, having no vital child. The clinical features of subjects were listed earlier to include in the present investigation. All the subjects were assessed for multiple recognized problems of abortions, such as chromosome abnormalities,  hormone levels of follicle-stimulating hormone (FSH), luteinizing hormone (LH), antiphospholipid antibodies, lupus anticoagulant and anticardiolipin antibodies and other risk factors reported previously (ghorbian et al, 2012;  Parveen et al, 2015). The control group consisting of 100 healthy women (mean age ± S.D., 31.31 ± 1.82 years of the related ethnic population with at least 1 live child and no historical abortions, pre-eclampsia, ectopic gestation, preterm birth, and other abnormality. The aforementioned investigation was confirmed by the Ethics Review Board of Tabriz International Hospital and signed informed consents were obtained from of all the women.

 

2.2 Genotyping

Genetic variants in the miR-499A > G   and miR-196a2T >C were examined in 100 subjects with RPL and 100 control participants. For all of the subject, we were obtained 3mL peripheral blood specimens for SNP analysis in case- control groups. Genomic DNA was extracted from collecting blood in the presence of anticoagulant using salting-out protocol, which was described previously by Miller et al (Miller et al, 1988). Nucleotide changes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. The polymorphic region was extended by PCR utilizing a Thermal Cycler (Eppendorf) in a 25 µL reaction the solution comprising 50 ng of genomic DNA, 12.5 µL of 2X Master Mix Red (Amplicon), and each of primers at a final concentration of 10 pmole. Annealing temperatures obtained for rs11614913 at 59 oC and  rs3746444 at 58.5 oC. The primer sequence for generating a 149 bp product miR-196a  ( rs11614913) was used (F): 5?- CCC CCT CCC TTC TCC TCC AGA TA-3? and  (R) 5?- CGAAAACCGACTGATGTAACTCCG -3?, to amplify a 146 bp product for miR-499 (rs3746444) used the primer sequence (F):5?-  CAAAGTCCTCACTTCCCTGCCA-3?and (R)5?-ATGTTTAACTCCTCTCCACGTGATC-3?. Restriction enzyme digestion was performed using the following enzymes and conditions according to the manufacturer’s instructions; MSPI and BclI (Thermo Fisher Scientific company) for miR-196a (rs11614913), miR-499 (rs3746444), at 37°C for 16 hours, respectively. PCR product digested was separated on non-denaturing polyacrylamide gel (12%) and stained with silver nitrate. We approved genotypes repeatedly by sequencing 10% of the specimens via random selection.

 

2.3 Statistical analysis

The differences in genotype and allele combination frequencies between unexplained RPL subjects and control groups were compared using the multivariate logistic regression and Fisher’s exact test, respectively. Allele frequencies were calculated to identify deviations from Hardy–Weinberg equilibrium. Odds ratios (ORs), and 95% confidence intervals (CIs) were used to measure the strength of association between genotypes and unexplained RPL. Two-tailed P values <0.05 were considered statistically significant.      Results: To investigate whether the two SNPs in miR-196a2 T>C and miR-499 A>G endured in East Azerbaijan Province of Iran, Tabriz women and whether they contributed to unexplained RPL experience or negative, we studied these SNPs in 100 RPL patients and 100 relevant controls. For overwhelming the influences of disturbing factors, the case and control groups were matched regarding the age and ethnicity. The frequency of two nucleotide variants studied was not in Hardy–Weinberg equilibrium. The miR-196a2T>C and miR-499A>G frequencies in the RPL and healthy groups are demonstrated in Table 3.

 The delivery frequencies of genotypes TT, TC, and CC of miR-196a2T>C SNP were 14%, 53%, and 33%, respectively, in the case group; whereas, the frequencies of three genotypes in the control group were 9%, 62%, and 29%, respectively. When the miR-196a2T>C  polymorphism assesses, the frequencies were different between unexplained RPL women and controls, while the differences were not statistically significant (p= 0.904), Table 1.

Of the 100 RPL patients investigated for the miR-196a2 T>C polymorphism, the frequency of the allele C (0.595) was similar to the control group (0.6), and there was not a significant difference between the two groups (P = 0.295; OR = 0.698; 95% CI, 0.567 – 1.194).

In addition, were not found a significant difference in genotype distribution of miR-499A>G  within in the RPL patients compared with controls (P=0.091), Table 2.  The distribution frequencies of genotypes AA, AG, and GG of miR-499A>G SNP were 29%, 38%, and 33%, respectively, in the case group; whereas, the frequencies of three genotypes in the control group were 45%, 36%, and 19%, respectively. Also, the frequency of the allele G (0.52) was higher than for the control group (0.37), but not revealed a significant difference between the two groups (P = 0.945; OR = 0.764; 95% CI, 0.764 – 1.113). Table 3.

 

 

Discussion

The RPL causes remained approximately more than 50% unknown. There are several possible mechanisms that demonstrate why miRNA polymorphisms may be correlated with abortion (Jung et al, 2014; Li et al, 2016). The purpose of the present study was to evaluate the potential roles of miR-196a2 T>C and miR-499 A>G gene polymorphism in the etiology of unexplained RPL. miRNA polymorphism may change receptivity of the endometrium and influence implantation failure, which leads to the recurrent abortion. Of note, receptivity of endometrial stroma is one of the critical levels for trophoblast invasion and placenta progress during successful pregnancy. Two of pre-miRNA SNPs (miR-196a2T>C and miR-499A>G) have been revealed that positive relationships with different types of carcinoma, then, they may have a significant impact on RPL through cell proliferation (Wang  et al, 2016; Ryan et al, 2010; Toraih et al, 2016). The unusual cell proliferation may be changed the condition of endometrium in RPL sufferers. Preliminary data confirming the role of abnormal cell proliferation in RPL, which was enhanced with the risk of miscarriage rate and correlated with polymorphisms of the cell cycle-related genes (Fang et al, 2009). Our findings were not revealed significant different frequencies of the miR-196a2CC  between case and control groups. Contradictory to our results, Jeon et al reported that patients showed significantly different frequencies of the miR-196a2CC compared with the control group (Jeon et al, 2012). The similarity to the previous study (Jeon et al, 2012), Parveen et al, assessed the potential risk factor of miR-196a2 polymorphism between women suffering from of unexplained recurrent abortion and healthy group in the North Indian women, which was disclosed an increased risk allelic level in miR-196aT > C of RPL (Parveen et al, 2015). In addition, Jeon et al, focused this nucleotide variation in the aborted fetuses, and the findings showed that significantly different frequency of the miR-196a2CC genotypes compared with control subjects (Jeon et al, 2012). Also, previous findings suggested that a significant role for these miRNAs in cell proliferation and differentiation in spontaneous miscarriage, while our findings disagree with those. It is significant to notice the purposes of miR-499 and miR-196a2. The previous investigation showed that increased levels of miR-196a2 influences mRNA expression of the HOX family of genes and Akt signaling  (Makker et al, 2012) which are linked to endometriosis (Vitiello et al, 2007) and miscarriages (Jeon et al, 2012). Moreover, the critical role of HOX genes has been linked in implantation (Makker et al, 2012).  HOXB8, the target of miR-196a2, (Fujino et al, 2001) is vital for the myeloid differentiation and limb development (Hornstein et al, 2005). The target of miR-499 is SOX6, as a transcriptional repressor (Sluijter et al, 2010), which suppresses the expression of fibroblast growth factor (FGF) (Murakami et al, 2001 ).  FGF-3 performs a role in cell proliferation and differentiation in developing embryonic tissues (Jakobovits et al, 1986). SOX6, FGF-3, and miR-499 are probably practically associated, and previous evidence confirming that linkage is the relationship of the miR-499A>G polymorphism with breast carcinoma (Ryan et al, 2010). According to discussed before, the targets of miR- 196a2 and miR-499 are similarly linked with cellular proliferation and differentiation. Furthermore, miRNA polymorphisms are possibly influenced that the expression model of mature miRNAs procedure. Importantly, similar to the miR-196a2, we did not find the positive association between miR499 polymorphism with the increased the risk of RPL compared to the control group. Contradictory to our results, Parveen et al, have been reported that alleles and genotype frequencies of miR-499 A > G were considerably significant risks in the patients with RPL  compared to the controls (Parveen et al, 2015). Similarity, Jeon et al, was found the combination of miR-196a2CC and miR-499AG+GG synergistic effects to RPL (Jeon et al, 2012). In accordance with our data which did not show the association of the increased risk of  RPL with miR-499 polymorphism, in another study that confirms the negative association between this variant and RPL, Jeon et al, reported that the frequencies were different between chromosomally abnormal spontaneously aborted fetuses and control subjects, but the differences were not statistically significant (Jeon et al, 2012). In general, our investigation showed that the miR-196a2 and miR-499 polymorphisms are not more frequently seen among patients with RPL, compared with healthy controls. This finding suggests the possibility that these polymorphisms do not increase RPL susceptibility.

 

Conclusion

These findings suggested that miR-196a2T>C and miR-499A>G polymorphisms could not contribute to RPL and it’s conceivable that not necessary for evaluating RPL patients in Azari-Iranian women. However, further studies are needed to clarify the positive or negative associations between the miRNA polymorphisms and RPL women in diverse ethnic populations.